9/16/2020

My protein is  UniProt:Q9BZP6 CHIA (1x) or acidic mammalian chitinase.

This week we did research on NCBI. For our proteins, we searched the conserved domains , searched the nucleotide database, did a BLAST, and checked out primers.

I got a bit confused with my protein. I tried all sorts of search variants from just “Q9BZP6” to “CHIA” to “acidic mammalian chitinase.” Due to relevance, I included the summaries for “Q9BZP6” and “CHIA”. Search 1 said there was nucleotide results, but when I clicked on them it took me straight to the protein page. It allowed a protein BLAST, but not an option to make primers. Search 2 is a search on the CHIA gene itself. I included the conserved domain for search 2. The BLAST I included is for search 2, as well as the primers.
 
Search 1 (Q9BZP6)
 
This is the protein itself. These results have no discrepancies with the results given by UniProt.

 Locus: CHIA_HUMAN
 Size: 476 aa
 Accession: Q9BZP6
 Version: Q9BZP6.1
 COMMENT     On or before Oct 31, 2007 this sequence version replaced
            gi:121942281, gi:121942282, gi:121942427, gi:74736195, gi:74756871.
            [FUNCTION] Degrades chitin and chitotriose. May participate in the
            defense against nematodes, fungi and other pathogens. Plays a role
            in T-helper cell type 2 (Th2) immune response. Contributes to the
            response to IL-13 and inflammation in response to IL-13. Stimulates
            chemokine production by pulmonary epithelial cells. Protects lung
            epithelial cells against apoptosis and promotes phosphorylation of
            AKT1. Its function in the inflammatory response and in protecting
            cells against apoptosis is inhibited by allosamidin, suggesting
            that the function of this protein depends on carbohydrate binding.
            {ECO:0000269|PubMed:11085997, ECO:0000269|PubMed:18824549,
            ECO:0000269|PubMed:19342690, ECO:0000269|PubMed:19435888}.
            [CATALYTIC ACTIVITY] Reaction=Random endo-hydrolysis of
            N-acetyl-beta-D-glucosaminide (1->4)-beta-linkages in chitin and
            chitodextrins.; EC=3.2.1.14; Evidence={ECO:0000269|PubMed:18824549,
            ECO:0000269|PubMed:19241384, ECO:0000269|PubMed:19435888}.
            [SUBUNIT] Interacts with EGFR. {ECO:0000269|PubMed:18824549,
            ECO:0000269|PubMed:19241384}.
            [INTERACTION] Q9BZP6; Q5RI15: COX20; NbExp=3; IntAct=EBI-14357960,
            EBI-2834035; Q9BZP6; P00533: EGFR; NbExp=2; IntAct=EBI-14357960,
            EBI-297353; Q9BZP6; Q8NC74: RBBP8NL; NbExp=3; IntAct=EBI-14357960,
            EBI-11322432; Q9BZP6; Q92609: TBC1D5; NbExp=3; IntAct=EBI-14357960,
            EBI-742381.
            [SUBCELLULAR LOCATION] [Isoform 1]: Secreted. Note=Secretion
            depends on EGFR activity.
            [SUBCELLULAR LOCATION] [Isoform 2]: Cytoplasm.
            [SUBCELLULAR LOCATION] [Isoform 3]: Cytoplasm.
            [ALTERNATIVE PRODUCTS] Event=Alternative splicing; Named
            isoforms=3; Name=1; IsoId=Q9BZP6-1; Sequence=Displayed; Name=2;
            Synonyms=TSA1902-L; IsoId=Q9BZP6-2; Sequence=VSP_008635; Name=3;
            Synonyms=TSA1902-S; IsoId=Q9BZP6-3; Sequence=VSP_008634.
            [TISSUE SPECIFICITY] Detected in lung epithelial cells from asthma
            patients (at protein level). Highly expressed in stomach. Detected
            at lower levels in lung. {ECO:0000269|PubMed:11085997,
            ECO:0000269|PubMed:15192232}.
            [INDUCTION] Up-regulated in lung epithelial cells from asthma
            patients. {ECO:0000269|PubMed:15192232}.
            [SIMILARITY] Belongs to the glycosyl hydrolase 18 family. Chitinase
            class II subfamily. {ECO:0000305}.
 
Search 2 (CHIA)

Conserved Domain:

The GH18 (glycosyl hydrolase, family 18) type II chitinases hydrolyze chitin, an abundant polymer of beta-1,4-linked N-acetylglucosamine (GlcNAc) which is a major component of the cell wall of fungi and the exoskeleton of arthropods. Chitinases have been identified in viruses, bacteria, fungi, protozoan parasites, insects, and plants. The structure of the GH18 domain is an eight-stranded beta/alpha barrel with a pronounced active-site cleft at the C-terminal end of the beta-barrel. The GH18 family includes chitotriosidase, chitobiase, hevamine, zymocin-alpha, narbonin, SI-CLP (stabilin-1 interacting chitinase-like protein), IDGF (imaginal disc growth factor), CFLE (cortical fragment-lytic enzyme) spore hydrolase, the type III and type V plant chitinases, the endo-beta-N-acetylglucosaminidases, and the chitolectins. The GH85 (glycosyl hydrolase, family 85) ENGases (endo-beta-N-acetylglucosaminidases) are closely related to the GH18 chitinases and are included in this alignment model.

--------------------------

 Since this search is on the CHIA gene itself, and not on the protein, I couldn’t really
compare the results to UniProt’s results for my protein. UniProt does say the gene for acidic mammalian chitinase is the CHIA gene, so that is accurate.

 Locus: DQ050696
 Size: 1406 bp
 Accession: DQ050696
 Version: DQ050696.1
 COMMENT     This sequence was made by sequencing genomic exons and ordering them based on             alignment. Translation starts at the beginning of alignment.

BLAST Graphic Summary (Search 2: CHIA)
 I only included the BLAST for search 2 because I could also get primers for this result.



Question: Are there any results in a species other than Homo sapiens that has a low E-value, high percent identity, and high percentage of query cover? 

Answer: Yes! Mus musculus (house mouse) had a low E score also, 0.0, which was the same as Homo sapiens. The percent identity of Mus musculus is 83.89%, and the query cover is 99%.

Primers (Search 2: CHIA)

Primer 1

Forward primer: ATGCCTGACAACATCGACCC

Reverse primer: GGTGCTCCATTGTCCTTCCA

Primer 2

Forward primer: CATGCCTGACAACATCGACC

Reverse primer: TGGCGGTTCTCAGGAGTAGA

 
Citations (In order as they appear in paper)
 
Protein [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; [1988] - [cited 2020 Sep 14]. Available from:

Lu, S., Wang, J., Chitsaz, F., Derbyshire, M. K., Geer, R. C., Gonzales, N. R., Gwadz, M., Hurwitz, D. I., Marchler, G. H., Song, J. S., Thanki, N., Yamashita, R. A., Yang, M., Zhang, D., Zheng, C., Lanczycki, C. J., & Marchler-Bauer, A. (2020). CDD/SPARCLE: the conserved domain database in 2020. Nucleic acids research, 48(D1), D265–D268. https://doi.org/10.1093/nar/gkz991
 
Nucleotide [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; [1988] - . Accession No. DQ050696 , Homo sapiens CHIA gene, VIRTUAL TRANSCRIPT, partial sequence, genomic survey sequence; [cited 2020 Sep 14]. Available from: https://www.ncbi.nlm.nih.gov/nuccore/DQ050696.1

Comments

  1. KaylynnSeptember 25, 2020 at 9:40 AM

    Hello Kathleen,

    Search 1 appears to be just a protein query. That's most likely why you cant get a nucleotide sequence. You would have to reverse translate the protein sequence in order to get the nucleotide sequence. Realize though this can introduce some issues (look into why this is the case).

    Also it is very important to pay attention to the percent identity of a given gene or protein to other species. Why would this be important?

    -Chad

    ReplyDelete

Post a Comment

Popular posts from this blog

Week 13

Image
Last week of lab. I did another gel today with Jaira which was pretty fun! No results again kinda.... D. rad had a line.... I did take a picture, and noticed a possible second line under row 6... but it’s lower than the ladder, so It’s definitely not in the right spot lol.
Read more

Blog Post 2 -- Spring 2023 -- Professional Identity

 Hello! The second blog post for this semester is about professional identity. My interpretation of professional identity is basically how you want to be viewed as a professional. For example, how much of your authentic-self do you want to show, and how much is appropriate; do you want to be viewed as a leader; do you want to be the type of professional who wants to go to work, do their job, and not have to worry about bossing people around? I think your professional identity varies based on the field you are in in STEM, and what activity you are doing. A biologist might be able to dress fairly casually in the lab, but when they are presenting at a research conference it is important to dress up professionally in order to gain more respect. Engineers tend to dress fairly casually. As a software engineer, my dad would dress in jeans in a collared shirt for work in the office even. He was never working face-to-face with clients or customers, so there was no point in requiring everyon...
Read more

Semester 2 week 4

Image
This week we did a gel on Tuesday, 1/4/2020. I came in late, so they were already in the middle of it. This was for samples 1, 7, 8, and 14. Nothing showed, possibly because the gel was too thin and hardened inconsistently.  We discussed options, and decided Chad would run PCR again and run a gel on the 4 samples again. He succeeded in getting 1, 7, and 8 to show, but not pimensis.  1/7/2020 We did DNA isolation on pimensis. The numbers were low, only 27 ng/micro Liter, so we did DNA isolation on pimensis again on 1/8/2020. We are awaiting to use the nanodrop to get the results for this DNA isolation. 
Read more